Suggested problems

HOW TO FIX “REPLACE BROTHER DRUM” ERROR MESSAGE?

Dec. 21, 2019, 12:17 p.m. by printerhelpcenter

Biological Motivation

The Replace Brother drum is a widespread printer problem encountered by the users, and thus here we have tabled the printer troubleshooting steps to resolve the issue. Through the help of the steps discussed below, the users can efficiently solve the problem. If not through this article, then the users can also take printer help from the experts of printer service.

Through the printer troubleshooting steps mentioned below, it would become easy for all users to get out of trouble. The Replace Brother Drum is a quite common printer error and can be quickly resolved by applying the printer troubleshooting steps enlisted below.

Details mentioned in this post.

What is a brother drum? A drum unit is a tube or a green metal cylinder consisting of a static electric charge which attracts the toner powder through the toner cartridge and applies it to the paper as it passes through the printer. Therefore, the drum unit is a maintenance item of the brother printer that sometimes needs to get replaced but not often a toner cartridge.

How to replace the brother drum? To replace Brother Drum, for all users, we’ve penned the [printer troubleshooting steps][1] to resolve the printer problem. Therefore, carefully go through the details discussed below and follow the same to replace brother drum.

First of all, carefully open the front flap of the printer and then find the toner printer cartridge.

After this, check under the toner cartridge unit, there is a drum unit. Now, the user will have to pull out the toner cartridge by pulling the green toner locking leavers down. Then slowly pull the printer cartridge out of the machine and then place that on the flat surface. Press the green leaver on the toner cartridge and lift the toner of the drum unit. After this, replace the drum unit and then lock the toner and re-insert them carefully.

What are the ways to find, remove and replace the Brother Drum unit? The users who are unable to find and replace the Brother Drum unit, for them, we’ve penned the easy and straightforward printer troubleshooting steps.

In the brother printer, the drum unit is mostly attached to the toner cartridge of most models.

Then open the front flap of the printer, and later try to find the toner cartridge along which will be attached to the drum unit also.

In case, if you fail to find the toner cartridge, then take reference from the manual of the printer and get aware of the exact location of the printer cartridge.

Once located, you can see a green-coloured toner lever that you need to pull out and keep it flat on a plan and protected surface.

After this, you will be able to see a green-coloured lever on the toner cartridge.

Then press it to lift the toner from the drum.

After doing this, the user can easily replace the drum unit.

Now on the top of the drum unit, lock the toner cartridge and then insert it back inside the printer again.

After some time, the user has to re-insert the drum into the printer, and then it might start functioning again without any prior display of “Replace Drum”.

So, the above mentioned are the printer troubleshooting steps to fix the “Replace Brother Drum” error. If there is any user who seeks for a printer help, then they all are suggested to get in touch with the printer service team and ask for an instant solution to get out of trouble.

[1]: https://printerhelpcenter.com/replace-brother-drum-error-message/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21