Suggested problems

Nursing Research Paper Writing Experts

Dec. 20, 2019, 6:47 a.m. by leahmelda

Biological Motivation

Our writing services are well-known for [Nursing Research Paper Writing Services][1] and Reliable [Nursing Paper Writing Services][2] when client seek [Nursing Research Paper Help Services][3].

[1]: https://researchpapers247.com/nursing-research-paper-services/ [2]: https://researchpapers247.com/nursing-research-paper-services/ [3]: https://researchpapers247.com/nursing-research-paper-services/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21