Suggested problems

How to Fix Brother Printer Errors?

Dec. 11, 2019, 9:11 a.m. by alexa thomson

Biological Motivation

When you face any issue affecting the performance of your printer or it’s not working properly, then instant solution by a technology expert is very crucial to tackle such kind of problems. Printer may display various problems such as connectivity related issues, network, spooler issues, or paper jam. All these problems can create havoc for the users. Hence you need to immediately contact [Brother Printer Support][1] expert and receive solution instantly.

visit here : [brother printer support number][2]

[1]: https://directorybuzz.co.uk/brother-printer-support [2]: https://fastdirectory.co.uk/brother-printer-support

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21