Suggested problems

Malwarebytes phone number that is fast and efficient

Dec. 10, 2019, 7:29 a.m. by Jasper Rex

Biological Motivation

If you are using Malwarebytes in your computer, you know you don’t need to worry about malware and all kinds of online threats that wait for you on the web. More information click here [Malwarebytes support][1] ...

[1]: https://www.assistanceforall.com/services/antivirus-support/malware-bytes-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21