Suggested problems

AOL mail support phone number

Dec. 9, 2019, 9:06 p.m. by marrymartin

Biological Motivation

AOL mail support phone number AOL is one of the oldest companies you can find in the online world. It was originally known as Online America and was soon renamed AOL. The interesting thing about AOL is that they are the pioneers of the Internet and have created some of the first online services that people will be able to access at their own leisure from the [AOL mail support phone number][1]. What makes the AOL email service amazing is that it has been developed for over a decade. It constantly adds new features, and the best thing is that it listens to the audience and needs it on the AOL customer service number. You need to visit our website http://webslivesupport.com/aol-customer-support/

[1]: http://webslivesupport.com/aol-customer-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21