Suggested problems

o no longer try to get a discount or declare Bangalore Escorts

Dec. 9, 2019, 8:45 a.m. by payal pandya

Biological Motivation

delight can appear, do no longer try to get a discount or declare Bangalore Escorts, these ladies love what they're doing and are professionals. All of you will be able to find a tremendous romance with a completely clean profile of Bangalore
https://nikithabangaloreescorts.com/escorts-location/escorts-girls-shivaji-nagar.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21