Suggested problems

Our Bangalore call girls are simply matured warm and sensible

Dec. 9, 2019, 8:38 a.m. by payal pandya

Biological Motivation

Our Bangalore call girls are simply matured warm and sensible they'll be satisfied with you an unattainable degree. In our Bangalore escort employer, you will have the method to easy the whole thing in line with your choice and decide on the deal.

https://nikithabangaloreescorts.com/young-and-sexy-call-girls-in-bangalore.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21