Suggested problems

Bangalore town The best and at ease Bangalore escorts carrier

Dec. 9, 2019, 8:26 a.m. by payal pandya

Biological Motivation

Welcome to the high-elegance. Bangalore town The best and at ease Bangalore escorts carrier. Our carrier and our purchaser's satisfaction headings were notion to be for international merchants of the respected guys or visitor of Bangalore https://www.bangaloreescortsonline.com/escorts-in-near-oberoi-hotel-bangalore.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21