Suggested problems

let or not it's the one to approach me first

Dec. 9, 2019, 8:24 a.m. by payal pandya

Biological Motivation

let or not it's the one to approach me first. the girl we provide could be full of power to serve you. our independent ladies give right care and delight to customers as they want. simply be part of our 24 Hours provider. https://www.ritudubey.com/ https://www.ritudubey.com/">bangalore escorts https://www.ritudubey.com/ ">bangalore escorts services https://www.ritudubey.com/">bangalore escorts agency

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21