Suggested problems

Methods to fix Error E-01 in Epson Printer | Dial @+1-866-748-5444

Dec. 2, 2019, 8:17 a.m. by Tanjaddaniel

Biological Motivation

The E-01 error code is identified as a serious error resulting in the printer being unable to complete the self-test method. When customers make a try on the printer, it will immediately check for multiple system errors. Follow the steps below with correct methods to repair [Epson Printer E-01 Error][1].

![enter image description here][2]

Step 1: Remove the power cable To remove the power cable from the wall outlet for at least 5 minutes, turn off the printer initially. Power the printer to check if this issue is still going on or not.

Step 2: Working with the Transportation lock Conferring to guidelines provided by experts from Epson Printer Support, it is necessary to execute the removal of the transport lock. Now, position the transport lock sensitively.

Step 3: Operating with the CD tray Confirm that you pressed the CD Tray switch to remove it to its storage location if the CD tray is in the eject position. Be careful not to push the CD tray into another position or even pull it up. Turn off the Epson printer to ensure that inside the device portion the document is not at all jammed.

Step 4: Working with the CISS feature If customers are working with the printer's CISS specifications, it is recommended to check whether the printer carriage is accomplished by moving effortlessly from left to right. The printer's higher scanner part is shut down strongly. The initialization process must begin while the critical customers run on the "Begin-Up scans" and the entire unit will start working again before the procedure is done. Occasionally all the ink tubes may stop cartridges from moving from left to right while working with the CISS. So it's recommended to use an original Epson ink cartridge now.

Step 5: Disassemble the Printer Get entry to the loading section of the cartridge if it is not in a working condition and move the carriage away from the stop. Okay, the paper route originates with progressive sensors attached to the paper tray, which only clashes with the width of the modification slide. Now, simply disassemble the printer and clean all the optical sensors, paper feed sensors, encoder strips and disk encoders.

Dial us at Epson Printer Customer Support for instant results

Connect with our technical team at Epson Printer Customer Service Number +1-866-748-5444 to allow us to help you in solving out complex of issues with absolute solutions. We are available 24 hours to bring users world-class solutions at their desk.We are accessible to customers 24*7 hours 365 days in a year. Our service charges are remarkably low in rates to match up customer’s beliefs.

[1]: https://www.errorcodeexpert.com/how-to-fix-epson-printer-error-code-e-01/ [2]: https://cdn.cp.adobe.io/content/2/dcx/e08c358a-f4ab-4f88-98b9-a9fa0d439e2b/rendition/preview.jpg/version/0/format/jpg/dimension/width/size/1200

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21