Suggested problems

special occasion hair styling

Nov. 26, 2019, 10:25 a.m. by kwhairandmakeupartistry

Biological Motivation

Key West Wedding Hair and Makeup Artistry is an award winning hair salon in Key West, voted Best of the Knot Weddings and Wedding Wire Bride’s Choice Awards. https://keywestweddinghairandmakeupartistry.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21