Suggested problems

How to Login to QuickBooks

Nov. 26, 2019, 3:51 a.m. by Amber Smith

Biological Motivation

When the users wish to understand the procedure of logging into QuickBooks software, then the steps which they would have to undertake are as mentioned below:  Navigate to the official website of QuickBooks using the web browser.  Then press the sign-in option which is available on the page.  Once the users press this option, they would then be redirected to a new page which would be the login page of QuickBooks.  Now they would have to provide the User ID and Password of their QuickBooks account in the respective field.  After the users have provided the required information, they can simply click on the sign-in button to access the account. If the users come across any query while incorporating the steps given, they would have the option of connecting with [QuickBooks Customer Care][1]. This service is easily accessible using a toll-free number. The trained executives at this service would ensure that the issue is rectified at the earliest.

Solved: [How to Login to QuickBooks][2]

[1]: https://www.easy-resolve.com/quickbooks/ [2]: https://www.easy-resolve.com/how-to-login-to-quickbooks/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21