Suggested problems

Quickbooks Support

Nov. 22, 2019, 10:14 a.m. by Quickbooks Support

Biological Motivation

If you Are A Business Owner, No Matter Small Or Big. Then You Should Be Checking Quickbooks Support because It Provides Best Accounting Services For Businesses. It Will Not Only Increase Accuracy But Will Save Time And Workload. Account Analyst Can Be Expensive For Some people, Especially For Small Business Owners. Let Me Tell Them They Don't Need To Worry Since There Is An Support Available For Them and That is Quickbooks Support. Click On The Given Link To Check Them Out. [Quickbooks Support][1]

[1]: https://qbsolutions.co/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21