Suggested problems

QuickBooks Mac Support Phone Number +1-866-502-0204

Nov. 21, 2019, 10:16 a.m. by Johnwilliams

Biological Motivation

QuickBooks has presented a number of versions in showcase that is persistently directing the business proprietors to manage and track accounting undertakings. As of late, QuickBooks has propelled a version for IOS clients named QuickBooks Mac Version. Give me a chance to determine you that this version is just perfect with Mac PCs and not with the Windows. This software can be bought for a one-time charge and use it to track of all your business accounting process. You can likewise get to the point by point reports to pick up knowledge of your business. As per the investigations, you can set aside time in accounting utilizing the QuickBooks Mac version. To know the working of QuickBooks mac version, call us at QuickBooks for Mac Support Phone Number. On the off chance that you are the one hoping to set up the organization record in QuickBooks for Mac, first you have to set up the organization document for Mac. After establishment, you have to set up the software appropriately to manage your accounting. For that, experience the underneath subtleties and keep them convenient.Call now Our [QuickBooks Mac Support Phone Number][1]

[1]: https://auditqwa.com/quickbooks-mac-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21