Suggested problems

we are offering best escorts and high profile models in gurgaon

Nov. 12, 2019, 11:09 a.m. by sakshi singh

Biological Motivation

Our Escorts in Gurgaon services conferred are not to be too expensive it will be always afforded to your pocket. Choosing any of the time of the day you will specifically create a selection from our Gurgaon photos gallery. Just in any case you need a spectacular escort’s service in Gurgaon for any special day, you will hire a special girl anytime. Please go to the escort gallery of our website for sexiest call girls in Gurgaon. Every professional man has different choices someone like fat women whereas some like slender girls with big curves. Some are prone to mature ladies whereas some like company of young women. No matter be your personal want, you’ll be at liberty to contact Gurgaon Escorts and call girls at no matter time you would like we are open 24X7 to assist you and to fulfill your desires, your feelings, and your willingness. You’ll delicately discuss details with the employees that are each useful and passionate.

http://www.gurgaonhotcollection.com/

http://www.gurgaonhotcollection.com/gallery/

http://www.gurgaonhotcollection.com/contact-us/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21