Suggested problems

How to disable McAfee real-time scanning on windows 10?

Oct. 23, 2019, 8:48 a.m. by Mcafee support

Biological Motivation

There is quite a time when users want to disable McAfee real-time scanning because they want to configure some other application but McAfee is stopping the software to install. So by disabling it, you can configure it. The steps which should be followed to disable McAfee real-time scanning on your Windows 10 system is given below: • From system tray right click on the McAfee • Now from the option that appeared first select Settings> Real-Time Scanning • In real time, Scanning window users need to turn off the button • Then you can choose when you want to resume the real-time scanning feature of the McAfee. Once you have selected click on Turn Off button to confirm it. If you are facing any issue while turning it off then you should not be worried as by just dialing McAfee Customer Care Number all your problem will be fixed. know more:- [url=https://customer-care-help.com/mcafee-antivirus-support/]Mcafee customer support[/url]| [url=https://customer-care-help.com/mcafee-antivirus-support/]Mcafee Contact Number[/url]| [url=https://customer-care-help.com/mcafee-antivirus-support/]Mcafee Helpline Number[/url]

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21