Suggested problems

Free Astrology Predictions For Career

Oct. 15, 2019, 5:38 a.m. by royravan0

Biological Motivation

In this age of cut-throat competition, it's forever wise to stay a step ahead of your rivals by not only innovating, but however also by streamlining your existing resources within the most economical method. And, of course, a bit advance information regarding what the future may hold, or what the star's foretell for your business, can be of immense help. The enlightening astrological report's covering totally different problem areas of [Free Astrology Predictions For Career][1] ready by professional astrologers provide you bright guidance, help you take away your obstacles and chart your growth through the coming days

[1]: https://astrosayings.com/astrology

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21